lekarze neurolodzy olsztyn

Wszystkie badania zostały zatwierdzone przez Ontario Career Institute Animal Care Committee. Genotypowanie myszy. Średni dzień obserwacji wtyczki został zliczony jako E0,5. Do analizy porównawczej wykorzystano embriony o podobnym stadium i generalnie z tego samego miotu. Genotypy zarodków zostały określone przy użyciu DNA wyizolowanego z worka żółtkowego lub małego kawałka tkanki embrionalnej; dla poporodowego DNA użyto ogonów. Multipleksowy PCR zaprojektowano do amplifikacji 3 zestawów starterów w pojedynczej reakcji, która może rozróżniać Koniec + / +, Koniec + /. I Koniec. /. allele. Wszystkie reakcje PCR prowadzono z początkową denaturacją przez 2 minuty w 94 ° C, następnie przez 30 cykli w 94 ° C przez 30 sekund, 56 ° C przez 35 sekund i 68 ° C przez 2,5 minuty, z końcowym wydłużeniem 68 ° C. C przez 5 minut. Reakcje zawierały 300 ng DNA, 400 | jM dNTP, 2,5 mM chlorek magnezu (MgCl2), U amppliTaq DNA polimeraza (Perkin Elmer, Roche Molecular Systems, Branchburg, New Jersey, USA), 40 pmol starterów ME1F i MEZR, i 20 pmol innych. Wybrane startery, 5. 3., Były: ME1F (TACCTCTGGATACCGGATAAG), ME1R (AAGTTTGGCATCCTATGAAAC), MEZR (AAATGTGAGCGAGTAACAACC), ME2F (ATCTTACCCACTGAGCCATCT) i ME2R (CCCAGTCTACTCCGATTCTTA). RT-PCR. RNA ekstrahowano z zarodków E9.5 za pomocą odczynnika TRIzol (GIBCO BRL, Mississauga, Ontario, Kanada), a g użyto do syntezy cDNA przy użyciu Superscript RT (GIBCO BRL). CDNA amplifikowano dla P-aktyny i endoglinu stosując zgłoszone startery (12). Warunki PCR były podobne do tych zastosowanych powyżej, z wyjątkiem 30 cykli wydłużania w 72 ° C przez 30 sekund, i końcowego z 5 minut, z zastosowaniem 1,5 mM MgCl2 i 200 | jM dNTP. Pełne wiązanie barwienia a-galaktozydazy (a-gal). Zarodki lub worki żółtkowe wycięto w PBS, utrwalono i barwiono, jak opisano (18), z wyjątkiem dodawania w 10% formaldehydzie (Fisher Scientific Co., Nepean, Ontario, Kanada). Zarodki były zatopione w parafinie, podzielone na sekcje (7. 10. M) i zabarwione kontrastowo 0,1% jądrowej czerwieni szybko (Fluka Chemica, Oakville, Ontario, Kanada). Obrazy uzyskano za pomocą mikroskopu Olympus BX50 połączonego z kamerą wideo CCD (Carsen Medical Scientific, Markham, Ontario, Kanada) i poddano cyfryzacji na komputerze Power Macintosh G3. Wyniki Generowanie myszy zerowych endoglin. Konstrukt targetowania konstruowano w celu usunięcia eksonu końcowego i jego kodonu inicjującego, zastępując go kasetą LacZ-Neo (Figura 1a). Przy użyciu analizy Southern blot zidentyfikowano 8 heterozygotycznych klonów komórek ES (End + / y), uzyskując częstotliwość rekombinacji wynoszącą 1/30. Wyniki uzyskane dla klonów 2 ES, które przekazały linię zarodkową, 4A-11 i 4A-36, zilustrowano na Figurze 1b. Zarodki uzyskane z krycia C57BL / 6 End + /. myszy genotypowano za pomocą multipleksowej PCR. Wyniki typowania miotu E9.5 przedstawiono na ryc. 1c. Two End. /. Zarodki endoglin wyrażały fragment 476-bp rekombinowanego allelu i fragment 383-bp z normalnego eksonu 2. Trzy zarodki typu dzikiego (End + / +) wykazywały normalne produkty PCR dla eksonu (300 pz) i eksonu 2 ( 383 pb). Four End + /. zarodki i End + /. matka (nr 21) pokazała wszystkie 3 produkty PCR. Aby zweryfikować, że docelowa mutacja inaktywowała gen, zbadaliśmy ekspresję mRNA końcowego w zarodkach analizowanych na rysunku 1c. Produkt 468-bp odpowiadający mysiemu endoglinowi (eksony 7. 10) był obecny w End + /. i zarodki End + / +, ale nieobecne w 2 End. /. zarodki. P-aktynę (550 pz) eksprymowano na równoważnych poziomach we wszystkich zarodkach. Tak więc nie wykryto mRNA endoglin typu dzikiego lub skróconego w End (3 (3). myszy (Figura 1d). Koniec./. myszy umierają w macicy przy E10. 10,5. Ekspresja y-galu, pod kontrolą promotora endoglinowego w wektorze kierującym, podsumowała endogenną ekspresję endoglinu w End + /. myszy i ułatwiła analizę End. /. fenotyp w zarodkach
[hasła pokrewne: choroba dekompresyjna, choroba somatyczna, choroba wieńcowa objawy ]